Phospho irf1

Author: pfst

August undefined, 2024

WebMay 13, 2024 · IRF-1 Antibody (E-4) is a mouse monoclonal IgG 2a κ IRF-1 antibody, cited in 19 publications, provided at 200 µg/ml specific for an epitope mapping between amino acids 307-328 at the C-terminus of IRF-1 of mouse origin IRF-1 Antibody (E-4) is recommended for detection of IRF-1 of mouse, rat and human origin by WB, IP, IF and ELISA WebIRF-1 is serine-phosphorylated by casein kinase II (CKII) at two clustered sites, one in the DNA-binding domain (amino acids 138-150) and another in the transactivation domain …

Co-Regulation of Immune Checkpoint PD-L1 with Interferon

WebIRF1-knockout HeLa cells were generated using the clustered, regularly interspaced palindromic repeats (CRISPR)/CRISPR-associated protein 9 (Cas9) system, which was performed by ToolGen (Seoul, South Korea). The sequence of single-guide (sg)RNA used to target the human IRF1 gene was CTCGGATGCGCATGAGACCC TGG. WebBackground: Antiviral innate immunity depends on the combination of parallel pathways triggered by virus detecting proteins in the Toll-like receptor (TLR) family and RNA helicases, such as Rig-I (retinoic acid-inducible gene I) and MDA-5 (melanoma differentiation-associated antigen 5), which promote the transcription of type I interferons (IFN) and … inception falling tests

Human IRF1 Antibody MAB4830: R&D Systems

WebAnti-FGFR1 (phospho Y654) antibody See all FGFR1 primary antibodies Description Rabbit polyclonal to FGFR1 (phospho Y654) Host species Rabbit Specificity Binds human and mouse FGFR1 only when phosphorylated at tyrosine 654 and rat FGFR1 only when phosphorylated at tyrosine 561. Tested applications Suitable for: ICC/IF, IHC-P, WB more … WebGet better batch-to-batch reproducibility with a recombinant antibody. Anti-IRE1 (phospho S724) antibody [EPR5253] (ab124945) Research with confidence – consistent and reproducible results with every batch. Long-term and scalable supply – powered by recombinant technology for fast production. WebJan 21, 2024 · The eponymous member of the interferon regulatory factor (IRF) family, IRF1, was originally identified as a nuclear factor that binds and activates the promoters of type … income protection insurance racv

Biomolecules Free Full-Text Sequential Interferon β-Cisplatin ...

MDM2 can act as an E3 ligase for IRF-1 in vitro and in cells (A ...

WebWe hypothesize that our methodology will enable the efficient identification of IRF-specific and pan-IRF inhibitors that can be used for the treatment of IRF-dependent disorders and malignancies. Introduction In 1988 the first interferon regulatory factor (IRF) was identified and named IRF1 ( 1, 2 ). WebApr 19, 2024 · Mutation of Tyr613 on IL-27Rα decreased IL-27-induced STAT1 phosphorylation by 80% but had limited effect on STAT3 phosphorgylation. Strong receptor/STAT coupling by IL-27 initiated a unique gene expression program, which required sustained STAT1 phosphorylation and IRF1 expression and was enriched in classical … income protection ioofWebIRF1 Transcriptional regulator which displays a remarkable functional diversity in the regulation of cellular responses. These include the regulation of IFN and IFN-inducible … income protection insurance reviews australia

"Another transcription factor of the IRF family important for antiviral defenses [6, 18], IRF1, has previously also been implicated with the DNA damage response [26]. We hypothesized that upon genotoxic insult, IRF1 might be a downstream target of the RLR/IRF3 pathway, as reported for virus infection [18], and thereby … See more To investigate the molecular links between DNA damage-induced cell death and innate immune signaling, we used A549 human lung carcinoma cells, as they … See more In order to investigate the contribution of antiviral signaling cascades to the induction of DSB-induced cell death, we compared the impact of the major antiviral … See more Above we have shown that RLR/IRF3 signaling as well as expression of IRF1 are important for DNA damage-induced cell death. Furthermore, across all conditions … See more " - Phospho irf1

Co-Regulation of Immune Checkpoint PD-L1 with Interferon

Human IRF1 Antibody MAB4830: R&D Systems

Phospho irf1

Did you know?